Viral IRES Prediction System  
Notification   Usage   Citations   Help   Home & analysis  
V



I



P



S
Viral IRES Prediction System (VIPS) :
    Internal ribosomal entry sites (IRESs) provide alternative, cap-independent translation initiation sites in eukaryotic cells. The IRES elements of the same class (group) might have conserved primary and secondary structures because of the functional contraction. IRESs have been applied as biotechnological tools, particularly for gene expression. Unfortunately, the lower homology between different IRES classes will cause inaccuracy of prediction by BLAST using primary sequences.

   

    The RNA structure prediction will therefore be useful to enhance the accuracy of de novo secondary structure prediction of IRES elements. Many RNA structure prediction models have been used in RNA structure simulation, but there is no suitable model or web service to predict the IRES element. Can a scientist predict the potential IRES element before experiment? Our previous pioneer IRES search system (IRSS) has provided the bioinformatic web service for IRES prediction to public.
    To set up the IRSS, two RNA structure prediction models, comparative structure analysis and minimum free energy structure, were implanted into the web-base server. The IRSS only predicted one IRES type. The application of IRSS service has published in BMC Bioinformatics in 2009. The IRSS web server has served over 1700 requests since 2009. However, there are four IRES types (groups) from literatures; in addition, RNA pseudoknot element might bind to the initiation codon of the mRNA that has attached the binding cleft with the 40S ribosomal subunit. To generate a new tool for all IRES groups, three RNA structure prediction models: comparative structure analysis, minimum free energy structure, and pseudoknot prediction were applied in our new system, viral IRES prediction system (VIPS).

   

    The accuracy rate of VIPS was assessed as 98.53%, 90.80%, 82.36% and 80.41% for IRES group 1, 2, 3, and 4, respectively. This advance useful approach for IRES structures will facilitate IRES related studies. The VIPS web service will execute the customers’ requests and perform all programs to compare four individual IRES group plus pseudoknot prediction and also create a web-page of results for users.

 

E-mail (Optional):

IRES Group        Threshold
Group1-CrPV
Group2-HCV
Group3-EMCV
Group4-PV

Pseudoknot Parameter

DNA / RNA Sequence:

           

Instruction of VIPS:

(1) Type your e-mail address (Optional).
(2) Select one or more IRES groups.
(3) Set the ratio threshold or use default value.
(4) Select the analysis whether the pseudoknot
      parameter is applicable or not.
(5) Input one DNA or RNA sequence, the format is
      described below.
(6) Your input sequence will be compared with your
      selected IRES groups.

Input sequence format:
   CGAUCGUAGCUACGUAUCGUACUGAUGCGA
   GUCUGACUGAUGCGUAGUCUGACU

* Please input only one sequence per analysis.
* The sequence should not include any symbols.
* The length of sequence should between 10 bp to
   5000 bp.

* For more information about the format of the result
   output, click the "Help" link.

* The result will be shown in a webpage and also sent
   through an e-mail after calculation is done.